Cystic Fibrosis (CFTR) 165 Pathogenic Variants with Reflex to Sequencing
Ordering Recommendation

For individuals with suspected CF. This test is NOT indicated for routine obstetric screening. If individual is not symptomatic, order Cystic Fibrosis (CFTR) 165 Pathogenic Variants (2013661).

Polymerase Chain Reaction/Fluorescence Monitoring/Sequencing
21-28 days
New York DOH Approval Status
This test is New York DOH approved.
ARUP Consult®
Disease Topics
Specimen Required
Patient Preparation
Lavender (EDTA), pink (K2EDTA), or yellow (ACD Solution). 
Specimen Preparation
Transport 3 mL whole blood. (Min: 2 mL) 
Storage/Transport Temperature
Unacceptable Conditions
Plasma or serum. Specimens collected in sodium heparin or lithium heparin tubes. 
Ambient: 72 hours; Refrigerated: 2 weeks; Frozen: 1 month 
Reference Interval
By report
Interpretive Data
Background information for Cystic Fibrosis (CFTR), 165 Pathogenic Variants with Reflex to Sequencing:
Characteristics of Classic Cystic Fibrosis (CF):
Chronic sino-pulmonary disease, gastrointestinal malabsorption/pancreatic insufficiency, and obstructive azoospermia. Symptoms of mild CF are often limited to a single organ system such as isolated pancreatitis, bilateral absence of the vas deferens, nasal polyposis, or bronchiectasis.
Incidence: 1 in 2,300 Ashkenazi Jewish, 1 in 2,500 Caucasians, 1 in 13,500 Hispanics, 1 in 15,100 African Americans, 1 in 35,100 Asians.
Autosomal recessive.
Penetrance: High for severe and moderately severe pathogenic variants, variable for mild pathogenic variants.
Cause: Two pathogenic CFTR variants on opposite chromosomes.
Pathogenic Variants Tested: Variants are listed by standard nomenclature. Legacy names are also provided for the 23 recommended ACMG variants. c.1A>G, p.Met1Val; c.14C>T, p.Pro5Leu; c.54-5940_273+10250del21kb, p.Ser18ArgfsX16; c.115C>T, p.Gln39X; c.178G>T, p.Glu60X; c.200C>T, p.Pro67Leu; c.223C>T, p.Arg75X; c.254G>A (Legacy G85E), p.Gly85Glu; c.262_263delTT, p.Leu88IlefsX22; c.273+1G>A, Intronic; c.274-1G>A, Intronic; c.274G>A, p.Glu92Lys; c.274G>T, p.Glu92X; c.292C>T, p.Gln98X; c.313delA, p.Ile105SerfsX2; c.325_327delTATinsG, p.Tyr109GlyfsX4; c.328G>C, p.Asp110His; c.349C>T, p.Arg117Cys; c.350G>A (Legacy R117H), p.Arg117His; c.366T>A, p.Tyr122X; c.442delA, p.Ile148LeufsX5; c.489+1G>T (Legacy 621+1G>T); c.509G>A, p.Arg170His; c.531delT, p.Ile177MetfsX12; c.532G>A, p.Gly178Arg; c.579+1G>T (Legacy 711+1G>T); c.579+5G>A, Intronic; c.579+3A>G, Intronic; c.580-1G>T, Intronic; c.595C>T, p.His199Tyr; c.613C>T, p.Pro205Ser; c.617T>G, p.Leu206Trp; c.658C>T, p.Gln220X; c.720_741delAGGGAGAATGATGATGAAGTAC, p.Gly241GlufsX13; c.803delA, p.Asn268IlefsX17; c.933_935delCTT, p.Phe312del; c.948delT, p.Phe316LeufsX12; c.988G>T, p.Gly330X; c.1000C>T (Legacy R334W), p.Arg334Trp; c.1001G>T, p.Arg334Leu; c.1007T>A, p.Ile336Lys; c.1021T>C, p.Ser341Pro; c.1022_1023insTC, p.Phe342HisfsX28; c.1040G>A, p.Arg347His; c.1040G>C (Legacy R347P), p.Arg347Pro; c.1052C>G, p.Thr351Ser; c.1054C>T, p.Arg352Trp; c.1055G>A, p.Arg352Gln; c.1081delT, p.Trp361GlyfsX8; c.1116+1G>A, Intronic; c.1127_1128insA, p.Gln378AlafsX4; c.1153_1154insAT, p.Asn386IlefsX3; c.1202G>A, p.Trp401X; c.1203G>A, p.Trp401X; c.1209+1G>A, Intronic; c.1329_1330insAGAT, p.Ile444ArgfsX3; c.1364C>A (Legacy A455E), p.Ala455Glu; c.1393-1G>A, Intronic; c.1397C>A, p.Ser466X; c.1397C>G, p.Ser466X; c.1400T>C, p.Leu467Pro; c.1418delG, p.Gly473GlufsX54; c.1438G>T, p.Gly480Cys; c.1466C>A, p.Ser489X; c.1475C>T, p.Ser492Phe; c.1477C>T, p.Gln493X; c.1486T>G, p.Trp496Gly; c.1519_1521delATC (Legacy I507del), p.Ile507del; c.1521_1523delCTT (Legacy F508del), p.Phe508del; c.1545_1546delTA, p.Tyr515X; c.1558G>T, p.Val520Phe; c.1572C>A, p.Cys524X; c.1573C>T, p.Gln525X; c.1585-1G>A (Legacy 1717-1G>A); c.1585-8G>A, Intronic; c.1624G>T (Legacy G542X), p.Gly542X; c.1645A>C, p.Ser549Arg; c.1646G>A, p.Ser549Asn; c.1647T>G, p.Ser549Arg; c.1651G>A, p.Gly551Ser; c.1652G>A (Legacy G551D), p.Gly551Asp; c.1654C>T, p.Gln552X; c.1657C>T (Legacy R553X), p.Arg553X; c.1675G>A, p.Ala559Thr; c.1678A>G, p.Arg560Gly; c.1679G>A, p.Arg560Lys; c.1679G>C (Legacy R560T), p.Arg560Thr; c.1680-1G>A, Intronic; c.1703delT, p.Leu568CysfsX4; c.1721C>A, p.Pro574His; c.1753G>T, p.Glu585X; c.1766+1G>A (Legacy 1898+1G>A); c.1766+3A>G, Intronic; c.1792_1798delAAAACTA, p.Lys598GlyfsX11; c.1923_1931del9insA, p.Ser641ArgfsX5; c.1973_1985del13insAGAAA, p.Arg658LysfsX4; c.2012delT, p.Leu671X; c.2051_2052delAA, p.Lys684ThrfsX4; c.2051_2052delAAinsG, p.Lys684SerfsX38; c.2052delA (Legacy 2184delA), p.Lys684AsnfsX38; c.2125C>T, p.Arg709X; c.2128A>T, p.Lys710X; c.2175_2176insA, p.Glu726ArgfsX4; c.2195T>G, p.Leu732X; c.2215delG, p.Val739TyrfsX16; c.2290C>T, p.Arg764Ter; c.2453delT, p.Leu818TrpfsX3; c.2464G>T, p.Glu822X; c.2490+1G>A, Intronic; c.2491G>T, p.Glu831X; c.2506G>T, p.Asp836Tyr; c.2537G>A, p.Trp846X; c.2551C>T, p.Arg851X; c.2583delT, p.Phe861LeufsX3; c.2657+5G>A (Legacy 2789+5G>A); c.2668C>T, p.Gln890X; c.2737_2738insG, p.Tyr913X; c.2780T>C, p.Leu927Pro; c.2810_2811insT, p.Val938GlyfsX37; c.2834C>T, p.Ser945Leu; c.2875delG, p.Ala959HisfsX9; c.2900T>C, p.Leu967Ser; c.2908G>C, p.Gly970Arg; c.2988+1G>A (Legacy 3120+1G>A); c.2988G>A, Intronic; c.2989-1G>A, Intronic; c.3038C>A, p.Pro1013His; c.3039delC, p.Tyr1014ThrfsX9; c.3067_3072delATAGTG, p.Ile1023_Val1024del; c.3140-26A>G, Intronic; c.3194T>C, p.Leu1065Pro; c.3196C>T, p.Arg1066Cys; c.3197G>A, p.Arg1066His; c.3230T>C, p.Leu1077Pro; c.3266G>A, p.Trp1089X; c.3276C>A, p.Tyr1092X; c.3276C>G, p.Tyr1092X; c.3297C>A, p.Phe1099Leu; c.3302T>A, p.Met1101Lys; c.3310G>T, p.Glu1104X; c.3472C>T, p.Arg1158X; c.3484C>T (Legacy R1162X), p.Arg1162X; c.3528delC (Legacy 3659delC), p.Lys1177SerfsX15; c.3587C>G, p.Ser1196X; c.3611G>A, p.Trp1204X; c.3612G>A, p.Trp1204X; c.3659delC, p.Thr1220LysfsX8; c.3717+12191C>T (Legacy 3849+10kbC>T); c.3731G>A, p.Gly1244Glu; c.3744delA, p.Lys1250ArgfsX9; c.3752G>A, p.Ser1251Asn; c.3763T>C, p.Ser1255Pro; c.3764C>A, p.Ser1255X; c.3773_3774insT, p.Leu1258PhefsX7; c.3846G>A (Legacy W1282X), p.Trp1282X; c.3873+1G>A, Intronic; c.3909C>G (Legacy N1303K), p.Asn1303Lys; c.3937C>T, p.Gln1313X; c.3964-78_4242+577del, Exon 22-23 del; c.4028delG, p.Gly1343AlafsX4; c.4046G>A, p.Gly1349Asp; c.4077_4080delTGTTinsAA, p.Val1360fsX3; c.4111G>T, p.Glu1371X; c.4251delA, p.Glu1418ArgfsX14; c.1679+1.6kbA>G. The IVS-8 variant, c.1210-12[5], will be reported when R117H is detected and in individuals that are reported to be symptomatic.
Clinical Sensitivity of 165-Variant Test:
Ashkenazi Jewish 96 percent; Caucasian 92 percent; Hispanic 80 percent; African American 78 percent; Asian American 55 percent.
Clinical Sensitivity for Sequencing: 97 percent.
Methodology for 165-Variant Test: Polymerase Chain Reaction (PCR) and fluorescence monitoring.
Methodology for Sequencing:
Bidirectional sequencing of the CFTR coding region and intron-exon boundaries.
Analytical Sensitivity & Specificity:
99 percent.
Diagnostic errors can occur due to rare sequence variations. Pathogenic CFTR promoter variants and large gene deletions/duplications will not be detected.

Compliance Statement C: The performance characteristics of this test were validated by ARUP Laboratories. The U.S. Food and Drug Administration (FDA) has not approved or cleared this test. However, FDA approval or clearance is currently not required for clinical use of this test. The results are not intended to be used as the sole means for clinical diagnosis or patient management decisions. ARUP is authorized under Clinical Laboratory Improvement Amendments (CLIA) and by all states to perform high-complexity testing. Counseling and informed consent are recommended for genetic testing. Consent forms are available online.

The 165-variant test includes the 23 pathogenic CF variants recommended by the American College of Medical Genetics for population carrier screening. If only one pathogenic variant is identified, then CFTR gene sequencing will be added. Additional charges apply.
CPT Code(s)
Component Test Code*Component Chart NameLOINC
2013675Cystic Fibrosis, Allele 142938-1
2013676Cystic Fibrosis, Allele 242939-9
2013681Cystic Fibrosis, 165 Var. w/Rflx, Interp
2013692Cystic Fibrosis 5T Variant21654-9
* Component test codes cannot be used to order tests. The information provided here is not sufficient for interface builds; for a complete test mix, please click the sidebar link to access the Interface Map.
  • CFTR M
  • CFTR mutation reflex test